rat immunoglobulin g (Santa Cruz Biotechnology)

Santa Cruz Biotechnology is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Santa Cruz Biotechnology rat immunoglobulin g
Rat Immunoglobulin G, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 253 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/normal+rat+immunoglobulin+g/normal+rat+IgG/pmc11394922-135-69-73
Average 94 stars, based on 253 article reviews

rat immunoglobulin g - by Bioz Stars, 2026-09

94/100 stars

Images

Positive Control:

Article Title: CCAAT/enhancer-binding protein β regulates interleukin-6-induced transmembrane and ubiquitin-like domain containing 1 gene expression in hepatocytes.
Article Snippet: A ChIP assay was performed using the EZ-ChIP kit (Millipore, Billerica, MA, USA) according to the manufacturer's instructions. .. The following antibodies were used: Anti-RNA polymerase as a positive control, normal rat immunoglobulin G as a negative control (Santa Cruz Biotechnology Inc.) and anti-C/EBPβ antibody in the experimental groups. .. Primer 5 software (Premier Biosoft, Palo Alto, CA, USA) was used to design the following primers for Tmub1 amplification: Forward primer, 5'‐TCTGCAAGCATAAGGACCTC‐3' and reverse primer, 5'‐ACTGAGCTAAATCCCCATCC‐3', (fragment length, 208 bp).

Negative Control:

Incubation:

Article Title: Ski Negatively Regulates Erythroid Differentiation through Its Interaction with GATA1
Article Snippet: After clarification, extracts were precleared with protein A/G-Sepharose (Amersham Biosciences) for 1 h at 4°C on a rotating wheel. .. GATA1 protein complexes were incubated with anti-GATA1 rat antibody (N6) or normal rat immunoglobulin G (IgG; Santa Cruz Biotechnology) plus rabbit anti-rat IgG (Sigma). .. The mouse GATA1 (mGATA1) zinc finger domain (the N-terminal zinc finger domain [NF] plus the C-terminal zinc finger domain [CF]; amino acids 178 to 300) was expressed as Myc-tagged protein and incubated with anti-Myc mouse antibody (9E10) or normal mouse IgG (Santa Cruz Biotechnology).

Staining:

Article Title: Arginase 2 Promotes Cisplatin-Induced Acute Kidney Injury by the Inflammatory Response of Macrophages.
Article Snippet: Acute kidney injury (AKI) is a complex clinical syndrome with a rapid decrease in renal function caused by several different etiologies, including sepsis, ischemia, and the administration of nephrotoxic drugs.. Tubular arginase 2 (ARG2), an arginine-metabolic enzyme, is a potential therapeutic target for AKI, but it has not been confirmed under various AKI conditions.. The aim of this study was to investigate ARG2 as a therapeutic target for cisplatin-induced AKI.

Review